Review



15140 122 jetprime polyplus 101000046 e coli cells sangon b528413 software flowjo v10  (Sartorius AG)


Bioz Verified Symbol Sartorius AG is a verified supplier
Bioz Manufacturer Symbol Sartorius AG manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    Sartorius AG 15140 122 jetprime polyplus 101000046 e coli cells sangon b528413 software flowjo v10
    15140 122 Jetprime Polyplus 101000046 E Coli Cells Sangon B528413 Software Flowjo V10, supplied by Sartorius AG, used in various techniques. Bioz Stars score: 99/100, based on 11397 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flowjo+software/jetPRIME+DNA%2FsiRNA/pm42800828-181-212-214
    Average 99 stars, based on 11397 article reviews
    15140 122 jetprime polyplus 101000046 e coli cells sangon b528413 software flowjo v10 - by Bioz Stars, 2026-11
    99/100 stars

    Images

    Related Articles

    Imaging:

    Article Title: Prolonging lung cancer response to EGFR inhibition by targeting the selective advantage of resistant cells
    Article Snippet: .. Luca Grumolato Jun 2, 2025 ChemiDoc Imaging System (Bio-Rad), QuantStudio Flex PCR System (Thermo Scientific), Beckman Coulter CytoFLEX, Infinite F200 PRO (TECAN), Illumina MiniSeq, Incucyte® S3 Live-Cell Analysis System (Sartorius), Axioscope 7 microscope, Exigo H400 system Prism 4 software from GraphPad (GraphPad Software Inc), Microsoft Excel LTSC MSO (16.0.14332.21031) 64 bits, Image Lab Software (version 6.0.1; Bio-Rad), QuantStudio Design and Analysis Software (v1.4.3; Thermo Scientific), CytExpert software (v2.5.0.77; Beckman Coulter), Imaris software (v10.0.2; Bitplane), Incucyte software (v2021C; Sartorius), FlowJo software (V10.10.0, Becton Dickinson). re p o rtfo lio | rep o rtin g su m m ary A pril2023 Data Policy information about availability of data All manuscripts must include a data availability statement. ..

    Article Title: Chikungunya virus uses the tetraspanins CD63, CD9, and CD151 to replicate in human synovial fibroblasts.
    Article Snippet: .. Oligonucleotides Silencer negative control no. 2 siRNA Thermo Fisher Scientific Cat# AM4613 Silencer GFP siRNA Thermo Fisher Scientific Cat# AM4626 CATCTGCACCCAAGTGTACCA microsynth qPCR CHIKV fw GCGCATTTTGCCTTCGTAATG microsynth qPCR CHIKV rev 6FAM-CggTgTACACTgCCTgTgACYgC—BBQ TIB MolBiol CHIKV probe Recombinant DNA pczVSV-G Hoffmann et al.43 https://doi.org/10.1099/vir.0.023978–0 pIRES2-eGFP CHIKV E3-E1 Salvador et al.44 https://doi.org/10.1016/j.virol.2009.07.013 pChik-LR-5‘GFP Tsetsarkin et al.40 https://doi.org/10.1089/vbz.2006.6.325 pChikRepl-eGFP Gläsker et al.45 https://doi.org/10.1186/1743-422X-10–23 pcDNA3.1(+) Addgene Cat# V790-20 Software and algorithms Fiji – ImageJ https://github.com/fiji/fiji Version 2.14.0/1.54f Graph Pad Prism Dotmatics Version 10 Incucyte Sartorius Version 2020 FlowJo FlowJo LLC Version 10.10.1 Huygens Compute Engine Scientific Volume Imaging Version 26.04 Adobe Illustrator Adobe Version 29.8.7 Affinity Studio Affinity Version 3.2.1 BioRender BioRender (https://biorender.com) RRID:SCR_018361 Other Chamber slides 8 well Ibidi Cat# 80841 Cell Reports 45, 118058, October 27, 2026 13 .. For each target, 3 siRNAs were purchased from Thermo Fisher Scientific and pooled for reverse transfection (Table S1).

    Polymerase Chain Reaction:

    Article Title: Prolonging lung cancer response to EGFR inhibition by targeting the selective advantage of resistant cells
    Article Snippet: .. Luca Grumolato Jun 2, 2025 ChemiDoc Imaging System (Bio-Rad), QuantStudio Flex PCR System (Thermo Scientific), Beckman Coulter CytoFLEX, Infinite F200 PRO (TECAN), Illumina MiniSeq, Incucyte® S3 Live-Cell Analysis System (Sartorius), Axioscope 7 microscope, Exigo H400 system Prism 4 software from GraphPad (GraphPad Software Inc), Microsoft Excel LTSC MSO (16.0.14332.21031) 64 bits, Image Lab Software (version 6.0.1; Bio-Rad), QuantStudio Design and Analysis Software (v1.4.3; Thermo Scientific), CytExpert software (v2.5.0.77; Beckman Coulter), Imaris software (v10.0.2; Bitplane), Incucyte software (v2021C; Sartorius), FlowJo software (V10.10.0, Becton Dickinson). re p o rtfo lio | rep o rtin g su m m ary A pril2023 Data Policy information about availability of data All manuscripts must include a data availability statement. ..

    Microscopy:

    Article Title: Prolonging lung cancer response to EGFR inhibition by targeting the selective advantage of resistant cells
    Article Snippet: .. Luca Grumolato Jun 2, 2025 ChemiDoc Imaging System (Bio-Rad), QuantStudio Flex PCR System (Thermo Scientific), Beckman Coulter CytoFLEX, Infinite F200 PRO (TECAN), Illumina MiniSeq, Incucyte® S3 Live-Cell Analysis System (Sartorius), Axioscope 7 microscope, Exigo H400 system Prism 4 software from GraphPad (GraphPad Software Inc), Microsoft Excel LTSC MSO (16.0.14332.21031) 64 bits, Image Lab Software (version 6.0.1; Bio-Rad), QuantStudio Design and Analysis Software (v1.4.3; Thermo Scientific), CytExpert software (v2.5.0.77; Beckman Coulter), Imaris software (v10.0.2; Bitplane), Incucyte software (v2021C; Sartorius), FlowJo software (V10.10.0, Becton Dickinson). re p o rtfo lio | rep o rtin g su m m ary A pril2023 Data Policy information about availability of data All manuscripts must include a data availability statement. ..

    Software:

    Article Title: Prolonging lung cancer response to EGFR inhibition by targeting the selective advantage of resistant cells
    Article Snippet: .. Luca Grumolato Jun 2, 2025 ChemiDoc Imaging System (Bio-Rad), QuantStudio Flex PCR System (Thermo Scientific), Beckman Coulter CytoFLEX, Infinite F200 PRO (TECAN), Illumina MiniSeq, Incucyte® S3 Live-Cell Analysis System (Sartorius), Axioscope 7 microscope, Exigo H400 system Prism 4 software from GraphPad (GraphPad Software Inc), Microsoft Excel LTSC MSO (16.0.14332.21031) 64 bits, Image Lab Software (version 6.0.1; Bio-Rad), QuantStudio Design and Analysis Software (v1.4.3; Thermo Scientific), CytExpert software (v2.5.0.77; Beckman Coulter), Imaris software (v10.0.2; Bitplane), Incucyte software (v2021C; Sartorius), FlowJo software (V10.10.0, Becton Dickinson). re p o rtfo lio | rep o rtin g su m m ary A pril2023 Data Policy information about availability of data All manuscripts must include a data availability statement. ..

    Article Title: Non-canonical activating roles of RCoR2 sustain transcription in adrenergic neuroblastoma.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER TrimGalore (v. 0.6.7) Babraham Bioinformatics 73 https://www.bioinformatics.babraham.ac. uk/projects/trim_galore/ HISAT2 (v. 2.2.1) Kim et al. 74 N/A StringTie (v2.1.7) Pertea et al. 75 N/A R package DESeq2 Love et al. 76 N/A Nextflow nf-core/atacseq pipeline (v. 2.1.2) nf-core 77 https://github.com/nf-core/atacseq HiC-Pro (v. 2.11.1) Servant et al. 78 N/A Juicebox Durand et al. 79 N/A GraphPad Prism-GraphPad Software (v. 9.5.1) GraphPad Software Inc RRID: SCR_002798 ImageJ ImageJ N/A GSEA (Broad Institute, v.4.3.2) Subramanian et al., Mootha et al. 80,81 N/A Incucyte® Software Sartorius N/A FlowJo TM BD Life Sciences N/A R2 genomics R2 genomics https://r2.amc.nl/ R (v.4.3.0) R Development Core Team https://www.R-project.org/ 20 Cell Reports ▪▪, 115951, ▪▪, 2025 OPEN ACCESS Whole cell lysates, nuclear extract and western blots To confirm RCOR1 and RCOR2 knockdown, whole-cell lysates were prepared in RIPA buffer (50 mM Tris-HCl pH 7.8, 150 mM NaCl, 1% NP-40, 0.5% DOC, 0.1% SDS, 2 mM Phenylmethylsulfonyl fluoride (PMSF), 1X Roche Complete Protease Inhibitor cocktail), while, because of an intense cytosolic unspecific band, RCoR3 levels were detected on nuclear extract. .. In particular, cells were washed in ice-cold PBS, resuspended in Ipotonic Buffer (10 mM HEPES, 50 mM NaCl, 0.5 mM DTT, 1 mM NaPiro, 1 mM NaOrtho, 1 mM NaFluor, 1 mM PMSF, 1X Roche Complete Protease Inhibitor cocktail) and pelleted by centrifugation at 300g for 5 min.

    Article Title: Chikungunya virus uses the tetraspanins CD63, CD9, and CD151 to replicate in human synovial fibroblasts.
    Article Snippet: .. Oligonucleotides Silencer negative control no. 2 siRNA Thermo Fisher Scientific Cat# AM4613 Silencer GFP siRNA Thermo Fisher Scientific Cat# AM4626 CATCTGCACCCAAGTGTACCA microsynth qPCR CHIKV fw GCGCATTTTGCCTTCGTAATG microsynth qPCR CHIKV rev 6FAM-CggTgTACACTgCCTgTgACYgC—BBQ TIB MolBiol CHIKV probe Recombinant DNA pczVSV-G Hoffmann et al.43 https://doi.org/10.1099/vir.0.023978–0 pIRES2-eGFP CHIKV E3-E1 Salvador et al.44 https://doi.org/10.1016/j.virol.2009.07.013 pChik-LR-5‘GFP Tsetsarkin et al.40 https://doi.org/10.1089/vbz.2006.6.325 pChikRepl-eGFP Gläsker et al.45 https://doi.org/10.1186/1743-422X-10–23 pcDNA3.1(+) Addgene Cat# V790-20 Software and algorithms Fiji – ImageJ https://github.com/fiji/fiji Version 2.14.0/1.54f Graph Pad Prism Dotmatics Version 10 Incucyte Sartorius Version 2020 FlowJo FlowJo LLC Version 10.10.1 Huygens Compute Engine Scientific Volume Imaging Version 26.04 Adobe Illustrator Adobe Version 29.8.7 Affinity Studio Affinity Version 3.2.1 BioRender BioRender (https://biorender.com) RRID:SCR_018361 Other Chamber slides 8 well Ibidi Cat# 80841 Cell Reports 45, 118058, October 27, 2026 13 .. For each target, 3 siRNAs were purchased from Thermo Fisher Scientific and pooled for reverse transfection (Table S1).

    Article Title: Engineering a compact CgCas12n platform for efficient genome and base editing in mammalian cells.
    Article Snippet: .. Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models HEK-293T ATCC CRL-3216 HeLa ATCC CCL-2 K562 ATCC CCL-243 N2a ATCC CCL-131 10 Molecular Systems Biology © The Author(s) Reagent/resource Reference or source Identifier or catalog number C2C12 ATCC CRL-1772 Mouse (C57BL/6), male, 4 weeks old Jiangsu GemPharmatech Co., Ltd SCXK (Su) 2018- 0008 Recombinant DNA AncBE4max Addgene #112094 ABE-max Addgene #112095 ABE-8e Addgene #138495 pCMV-nCas-PmCDA1 Addgene #79620 pCMV-AsCas12a Addgene #160140 pCMV-SpCas9 Addgene #139987 pGL3-U6-sgRNA-mCherry Our lab pCMV-CgCas12n Our lab pCMV-AcCas12n Our lab pCMV-enUnCas12f Our lab pCMV-TSminiCBE Our lab Antibodies Anti-Myhc DSHB MF 20 Anti-Dystrophin DSHB MANDRA1(7A10) Anti-Dystrophin Proteintech 12715-1-AP Anti-gapdh Proteintech 10494-1-AP Donkey anti-Mouse IgG (H+ L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 Invitrogen A-21202 Donkey anti-Rabbit IgG (H+ L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 555 Invitrogen A-31572 HRP Goat Anti-Rabbit IgG (H+ L) Abclonal AS014 HRP Goat Anti-Mouse IgG (H+ L) Abclonal AS003 Oligonucleotides and other sequence-based reagents Target sequence This study Appendix Tables S4–S8 Primer used for qPCR This study Appendix Table S9 Chemicals, enzymes, and other reagents Phanta Max Super-Fidelity DNA polymerase Vazyme P505 BasI-HFv2 NEB R3733 ClonExpress II One Step Cloning Kit Vazyme C116 DNA Ligase Solution I Takara 6022Q Dulbecco’s modified Eagle’s medium Gibco 12491015 FBS Gemini 100-106 Penicillin–streptomycin Gibco 15140-122 jetPRIME Polyplus 101000046 E. coli cells Sangon B528413 Software FlowJo v10 https://www.flowjo.com/flowjo10/ download Reagent/resource Reference or source Identifier or catalog number MEGA 12 https://www.megasoftware.net/ CRISPResso2 https://crispresso.pinellolab.org/ submission Cas-OFFinder http://www.rgenome.net/casoffinder ImageJ https://imagej.nih.gov/ij/index.html GraphPad Prism 8 https://www.graphpad.com Snapgene https://www.snapgene.com/ PyMol https://pymol.org/ Other Illumina NovaSeq (PE150) Novogene Technology (Beijing, China) Annaroad Gene Technology (Beijing, China) .. Mammalian codon-optimized sequences of Cas12n derived from Actinomadura craniellae (Ac) and Corynebacterium glutamicum (Cg) were synthesized by Genewiz and cloned into a CMV promoter-driven eukaryotic expression vector.

    Western Blot:

    Article Title: Non-canonical activating roles of RCoR2 sustain transcription in adrenergic neuroblastoma.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER TrimGalore (v. 0.6.7) Babraham Bioinformatics 73 https://www.bioinformatics.babraham.ac. uk/projects/trim_galore/ HISAT2 (v. 2.2.1) Kim et al. 74 N/A StringTie (v2.1.7) Pertea et al. 75 N/A R package DESeq2 Love et al. 76 N/A Nextflow nf-core/atacseq pipeline (v. 2.1.2) nf-core 77 https://github.com/nf-core/atacseq HiC-Pro (v. 2.11.1) Servant et al. 78 N/A Juicebox Durand et al. 79 N/A GraphPad Prism-GraphPad Software (v. 9.5.1) GraphPad Software Inc RRID: SCR_002798 ImageJ ImageJ N/A GSEA (Broad Institute, v.4.3.2) Subramanian et al., Mootha et al. 80,81 N/A Incucyte® Software Sartorius N/A FlowJo TM BD Life Sciences N/A R2 genomics R2 genomics https://r2.amc.nl/ R (v.4.3.0) R Development Core Team https://www.R-project.org/ 20 Cell Reports ▪▪, 115951, ▪▪, 2025 OPEN ACCESS Whole cell lysates, nuclear extract and western blots To confirm RCOR1 and RCOR2 knockdown, whole-cell lysates were prepared in RIPA buffer (50 mM Tris-HCl pH 7.8, 150 mM NaCl, 1% NP-40, 0.5% DOC, 0.1% SDS, 2 mM Phenylmethylsulfonyl fluoride (PMSF), 1X Roche Complete Protease Inhibitor cocktail), while, because of an intense cytosolic unspecific band, RCoR3 levels were detected on nuclear extract. .. In particular, cells were washed in ice-cold PBS, resuspended in Ipotonic Buffer (10 mM HEPES, 50 mM NaCl, 0.5 mM DTT, 1 mM NaPiro, 1 mM NaOrtho, 1 mM NaFluor, 1 mM PMSF, 1X Roche Complete Protease Inhibitor cocktail) and pelleted by centrifugation at 300g for 5 min.

    Knockdown:

    Article Title: Non-canonical activating roles of RCoR2 sustain transcription in adrenergic neuroblastoma.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER TrimGalore (v. 0.6.7) Babraham Bioinformatics 73 https://www.bioinformatics.babraham.ac. uk/projects/trim_galore/ HISAT2 (v. 2.2.1) Kim et al. 74 N/A StringTie (v2.1.7) Pertea et al. 75 N/A R package DESeq2 Love et al. 76 N/A Nextflow nf-core/atacseq pipeline (v. 2.1.2) nf-core 77 https://github.com/nf-core/atacseq HiC-Pro (v. 2.11.1) Servant et al. 78 N/A Juicebox Durand et al. 79 N/A GraphPad Prism-GraphPad Software (v. 9.5.1) GraphPad Software Inc RRID: SCR_002798 ImageJ ImageJ N/A GSEA (Broad Institute, v.4.3.2) Subramanian et al., Mootha et al. 80,81 N/A Incucyte® Software Sartorius N/A FlowJo TM BD Life Sciences N/A R2 genomics R2 genomics https://r2.amc.nl/ R (v.4.3.0) R Development Core Team https://www.R-project.org/ 20 Cell Reports ▪▪, 115951, ▪▪, 2025 OPEN ACCESS Whole cell lysates, nuclear extract and western blots To confirm RCOR1 and RCOR2 knockdown, whole-cell lysates were prepared in RIPA buffer (50 mM Tris-HCl pH 7.8, 150 mM NaCl, 1% NP-40, 0.5% DOC, 0.1% SDS, 2 mM Phenylmethylsulfonyl fluoride (PMSF), 1X Roche Complete Protease Inhibitor cocktail), while, because of an intense cytosolic unspecific band, RCoR3 levels were detected on nuclear extract. .. In particular, cells were washed in ice-cold PBS, resuspended in Ipotonic Buffer (10 mM HEPES, 50 mM NaCl, 0.5 mM DTT, 1 mM NaPiro, 1 mM NaOrtho, 1 mM NaFluor, 1 mM PMSF, 1X Roche Complete Protease Inhibitor cocktail) and pelleted by centrifugation at 300g for 5 min.

    Protease Inhibitor:

    Article Title: Non-canonical activating roles of RCoR2 sustain transcription in adrenergic neuroblastoma.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER TrimGalore (v. 0.6.7) Babraham Bioinformatics 73 https://www.bioinformatics.babraham.ac. uk/projects/trim_galore/ HISAT2 (v. 2.2.1) Kim et al. 74 N/A StringTie (v2.1.7) Pertea et al. 75 N/A R package DESeq2 Love et al. 76 N/A Nextflow nf-core/atacseq pipeline (v. 2.1.2) nf-core 77 https://github.com/nf-core/atacseq HiC-Pro (v. 2.11.1) Servant et al. 78 N/A Juicebox Durand et al. 79 N/A GraphPad Prism-GraphPad Software (v. 9.5.1) GraphPad Software Inc RRID: SCR_002798 ImageJ ImageJ N/A GSEA (Broad Institute, v.4.3.2) Subramanian et al., Mootha et al. 80,81 N/A Incucyte® Software Sartorius N/A FlowJo TM BD Life Sciences N/A R2 genomics R2 genomics https://r2.amc.nl/ R (v.4.3.0) R Development Core Team https://www.R-project.org/ 20 Cell Reports ▪▪, 115951, ▪▪, 2025 OPEN ACCESS Whole cell lysates, nuclear extract and western blots To confirm RCOR1 and RCOR2 knockdown, whole-cell lysates were prepared in RIPA buffer (50 mM Tris-HCl pH 7.8, 150 mM NaCl, 1% NP-40, 0.5% DOC, 0.1% SDS, 2 mM Phenylmethylsulfonyl fluoride (PMSF), 1X Roche Complete Protease Inhibitor cocktail), while, because of an intense cytosolic unspecific band, RCoR3 levels were detected on nuclear extract. .. In particular, cells were washed in ice-cold PBS, resuspended in Ipotonic Buffer (10 mM HEPES, 50 mM NaCl, 0.5 mM DTT, 1 mM NaPiro, 1 mM NaOrtho, 1 mM NaFluor, 1 mM PMSF, 1X Roche Complete Protease Inhibitor cocktail) and pelleted by centrifugation at 300g for 5 min.

    other:

    Article Title: Combining BET inhibition with SMAC mimetics restricts tumor growth and triggers immune surveillance in preclinical cancer models
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER CD80 (B7-1) BD CAT# 940141; RRID:AB_2876030 CD274 (B7-H1) BD CAT# 940142; RRID:AB_2876031 CD40 BD CAT# 940143; RRID:AB_2876032 CD24 BD CAT# 940144; RRID:AB_2876033 CD223 (LAG-3) BD CAT# 940152; RRID:AB_2876041 H-2Kb BD CAT# 940164; RRID:AB_2876052 CD197 (CCR7) BD CAT# 940165; RRID:AB_2876053 CD326 (Ep-CAM) BD CAT# 940169; RRID:AB_2876056 CD1d BD CAT# 940171; RRID:AB_2876058 CD54 (ICAM-1) BD CAT# 940172; RRID:AB_2876059 CD14 BD CAT# 940174; RRID:AB_2876061 CD278(ICOS) BD CAT# 940176; RRID:AB_2876063 CD273 (PD-L2) BD CAT# 940180; RRID:AB_2876066 H-2Kd BD CAT# 940194; RRID:AB_2876077 CD115 BD CAT# 940198; RRID:AB_2876081 CD137 (4-1BB) BD CAT# 940199; RRID:AB_2876082 CD172a (SIRPα) BD CAT# 940201; RRID:AB_2876084 CD45RB BD CAT# 940206; RRID:AB_2876088 CXCR2 BD CAT# 940209; RRID:AB_2876091 TCR Vγ1.1 BD CAT# 940334; RRID:AB_2876207 CD45Ra BD CAT# 940335; RRID:AB_2876208 CD8a BD CAT# 940345; RRID:AB_2876217 CD25 BD CAT# 940356; RRID:AB_2876227 CD83 BD CAT# 940350; RRID:AB_2876221 CD272 BD CAT# 940415; RRID:AB_2876275 Vγ 3 TCR BD CAT# 940354; RRID:AB_2876225 F4/80-L BD CAT# 940412; RRID:AB_2876273 CD44 BD CAT# 940114; RRID:AB_2876004 CD11b BD CAT# 940008; RRID:AB_2875899 cIAP1 Cell Signaling CAT# 7065; RRID:AB_10890862 cIAP2 Cell Signaling CAT# 3130; RRID:AB_10693298 XIAP Cell Signaling CAT# 14334; RRID:AB_2784533 GAPDH Abcam CAT# 8245; RRID:AB_2107448 PARP Cell Signaling CAT# 9542; RRID:AB_2160739 Caspase-3 Cell Signaling CAT# 14220; RRID:AB_2798429 Cleaved Caspase-3 Cell Signaling CAT# 9664; RRID:AB_2070042 Goat anti-Mouse IgG (H + L) Secondary Antibody DyLight 650 Novus NBP1-75147C; RRID:AB_3219020 Chemicals, peptides, and recombinant proteins Z-VAD-FMK Sigma-Aldrich V116-2MG Etanercept (Enbrel ) Pfizer Necrostatin-1 MedChemExpress HY-15760 BI 894999 Boehringer Ingelheim BI 891065 Boehringer Ingelheim HaltTM protease and phosphatase inhibitor cocktail Thermo Fisher Scientific 78440 MSD Tris Lysis Buffer MSD R60TX-2 Calcein AM Thermo Fisher C1430 Draq7 BD 564904 AMPure XP Beckman Coulter A63880 (Continued on next page) e2 Cell Reports Medicine 6, 102313, September 16, 2025 Article ll OPEN ACCESS

    Article Title: Combining BET inhibition with SMAC mimetics restricts tumor growth and triggers immune surveillance in preclinical cancer models.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER CD80 (B7-1) BD CAT# 940141; RRID:AB_2876030 CD274 (B7-H1) BD CAT# 940142; RRID:AB_2876031 CD40 BD CAT# 940143; RRID:AB_2876032 CD24 BD CAT# 940144; RRID:AB_2876033 CD223 (LAG-3) BD CAT# 940152; RRID:AB_2876041 H-2Kb BD CAT# 940164; RRID:AB_2876052 CD197 (CCR7) BD CAT# 940165; RRID:AB_2876053 CD326 (Ep-CAM) BD CAT# 940169; RRID:AB_2876056 CD1d BD CAT# 940171; RRID:AB_2876058 CD54 (ICAM-1) BD CAT# 940172; RRID:AB_2876059 CD14 BD CAT# 940174; RRID:AB_2876061 CD278(ICOS) BD CAT# 940176; RRID:AB_2876063 CD273 (PD-L2) BD CAT# 940180; RRID:AB_2876066 H-2Kd BD CAT# 940194; RRID:AB_2876077 CD115 BD CAT# 940198; RRID:AB_2876081 CD137 (4-1BB) BD CAT# 940199; RRID:AB_2876082 CD172a (SIRPα) BD CAT# 940201; RRID:AB_2876084 CD45RB BD CAT# 940206; RRID:AB_2876088 CXCR2 BD CAT# 940209; RRID:AB_2876091 TCR Vγ1.1 BD CAT# 940334; RRID:AB_2876207 CD45Ra BD CAT# 940335; RRID:AB_2876208 CD8a BD CAT# 940345; RRID:AB_2876217 CD25 BD CAT# 940356; RRID:AB_2876227 CD83 BD CAT# 940350; RRID:AB_2876221 CD272 BD CAT# 940415; RRID:AB_2876275 Vγ 3 TCR BD CAT# 940354; RRID:AB_2876225 F4/80-L BD CAT# 940412; RRID:AB_2876273 CD44 BD CAT# 940114; RRID:AB_2876004 CD11b BD CAT# 940008; RRID:AB_2875899 cIAP1 Cell Signaling CAT# 7065; RRID:AB_10890862 cIAP2 Cell Signaling CAT# 3130; RRID:AB_10693298 XIAP Cell Signaling CAT# 14334; RRID:AB_2784533 GAPDH Abcam CAT# 8245; RRID:AB_2107448 PARP Cell Signaling CAT# 9542; RRID:AB_2160739 Caspase-3 Cell Signaling CAT# 14220; RRID:AB_2798429 Cleaved Caspase-3 Cell Signaling CAT# 9664; RRID:AB_2070042 Goat anti-Mouse IgG (H + L) Secondary Antibody DyLight 650 Novus NBP1-75147C; RRID:AB_3219020 Chemicals, peptides, and recombinant proteins Z-VAD-FMK Sigma-Aldrich V116-2MG Etanercept (Enbrel ) Pfizer Necrostatin-1 MedChemExpress HY-15760 BI 894999 Boehringer Ingelheim BI 891065 Boehringer Ingelheim Halt TM protease and phosphatase inhibitor cocktail Thermo Fisher Scientific 78440 MSD Tris Lysis Buffer MSD R60TX-2 Calcein AM Thermo Fisher C1430 Draq7 BD 564904 AMPure XP Beckman Coulter A63880 (Continued on next page) e2 Cell Reports Medicine 6, 102313, September 16, 2025 OPEN ACCESS

    Article Title: Affinity-optimized TROP2 antibodies support potent antitumor activity in antibody–drug conjugates
    Article Snippet: Cells were stained with antibodies at 4 °C for 1 h. After three washes with PBS, HEK293T cells were incubated with goat anti-human IgG Alexa Fluor 488 (Thermo Fisher Scientific) at 4 °C for 1 h. Following three washes, stained cells were analyzed by flow cytometry on an iQue3 instrument (Sartorius), and the data were evaluated with FlowJo software X 10.0.7 (BD Biosciences).

    Negative Control:

    Article Title: Chikungunya virus uses the tetraspanins CD63, CD9, and CD151 to replicate in human synovial fibroblasts.
    Article Snippet: .. Oligonucleotides Silencer negative control no. 2 siRNA Thermo Fisher Scientific Cat# AM4613 Silencer GFP siRNA Thermo Fisher Scientific Cat# AM4626 CATCTGCACCCAAGTGTACCA microsynth qPCR CHIKV fw GCGCATTTTGCCTTCGTAATG microsynth qPCR CHIKV rev 6FAM-CggTgTACACTgCCTgTgACYgC—BBQ TIB MolBiol CHIKV probe Recombinant DNA pczVSV-G Hoffmann et al.43 https://doi.org/10.1099/vir.0.023978–0 pIRES2-eGFP CHIKV E3-E1 Salvador et al.44 https://doi.org/10.1016/j.virol.2009.07.013 pChik-LR-5‘GFP Tsetsarkin et al.40 https://doi.org/10.1089/vbz.2006.6.325 pChikRepl-eGFP Gläsker et al.45 https://doi.org/10.1186/1743-422X-10–23 pcDNA3.1(+) Addgene Cat# V790-20 Software and algorithms Fiji – ImageJ https://github.com/fiji/fiji Version 2.14.0/1.54f Graph Pad Prism Dotmatics Version 10 Incucyte Sartorius Version 2020 FlowJo FlowJo LLC Version 10.10.1 Huygens Compute Engine Scientific Volume Imaging Version 26.04 Adobe Illustrator Adobe Version 29.8.7 Affinity Studio Affinity Version 3.2.1 BioRender BioRender (https://biorender.com) RRID:SCR_018361 Other Chamber slides 8 well Ibidi Cat# 80841 Cell Reports 45, 118058, October 27, 2026 13 .. For each target, 3 siRNAs were purchased from Thermo Fisher Scientific and pooled for reverse transfection (Table S1).

    Real-time Polymerase Chain Reaction:

    Article Title: Chikungunya virus uses the tetraspanins CD63, CD9, and CD151 to replicate in human synovial fibroblasts.
    Article Snippet: .. Oligonucleotides Silencer negative control no. 2 siRNA Thermo Fisher Scientific Cat# AM4613 Silencer GFP siRNA Thermo Fisher Scientific Cat# AM4626 CATCTGCACCCAAGTGTACCA microsynth qPCR CHIKV fw GCGCATTTTGCCTTCGTAATG microsynth qPCR CHIKV rev 6FAM-CggTgTACACTgCCTgTgACYgC—BBQ TIB MolBiol CHIKV probe Recombinant DNA pczVSV-G Hoffmann et al.43 https://doi.org/10.1099/vir.0.023978–0 pIRES2-eGFP CHIKV E3-E1 Salvador et al.44 https://doi.org/10.1016/j.virol.2009.07.013 pChik-LR-5‘GFP Tsetsarkin et al.40 https://doi.org/10.1089/vbz.2006.6.325 pChikRepl-eGFP Gläsker et al.45 https://doi.org/10.1186/1743-422X-10–23 pcDNA3.1(+) Addgene Cat# V790-20 Software and algorithms Fiji – ImageJ https://github.com/fiji/fiji Version 2.14.0/1.54f Graph Pad Prism Dotmatics Version 10 Incucyte Sartorius Version 2020 FlowJo FlowJo LLC Version 10.10.1 Huygens Compute Engine Scientific Volume Imaging Version 26.04 Adobe Illustrator Adobe Version 29.8.7 Affinity Studio Affinity Version 3.2.1 BioRender BioRender (https://biorender.com) RRID:SCR_018361 Other Chamber slides 8 well Ibidi Cat# 80841 Cell Reports 45, 118058, October 27, 2026 13 .. For each target, 3 siRNAs were purchased from Thermo Fisher Scientific and pooled for reverse transfection (Table S1).

    Article Title: Engineering a compact CgCas12n platform for efficient genome and base editing in mammalian cells.
    Article Snippet: .. Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models HEK-293T ATCC CRL-3216 HeLa ATCC CCL-2 K562 ATCC CCL-243 N2a ATCC CCL-131 10 Molecular Systems Biology © The Author(s) Reagent/resource Reference or source Identifier or catalog number C2C12 ATCC CRL-1772 Mouse (C57BL/6), male, 4 weeks old Jiangsu GemPharmatech Co., Ltd SCXK (Su) 2018- 0008 Recombinant DNA AncBE4max Addgene #112094 ABE-max Addgene #112095 ABE-8e Addgene #138495 pCMV-nCas-PmCDA1 Addgene #79620 pCMV-AsCas12a Addgene #160140 pCMV-SpCas9 Addgene #139987 pGL3-U6-sgRNA-mCherry Our lab pCMV-CgCas12n Our lab pCMV-AcCas12n Our lab pCMV-enUnCas12f Our lab pCMV-TSminiCBE Our lab Antibodies Anti-Myhc DSHB MF 20 Anti-Dystrophin DSHB MANDRA1(7A10) Anti-Dystrophin Proteintech 12715-1-AP Anti-gapdh Proteintech 10494-1-AP Donkey anti-Mouse IgG (H+ L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 Invitrogen A-21202 Donkey anti-Rabbit IgG (H+ L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 555 Invitrogen A-31572 HRP Goat Anti-Rabbit IgG (H+ L) Abclonal AS014 HRP Goat Anti-Mouse IgG (H+ L) Abclonal AS003 Oligonucleotides and other sequence-based reagents Target sequence This study Appendix Tables S4–S8 Primer used for qPCR This study Appendix Table S9 Chemicals, enzymes, and other reagents Phanta Max Super-Fidelity DNA polymerase Vazyme P505 BasI-HFv2 NEB R3733 ClonExpress II One Step Cloning Kit Vazyme C116 DNA Ligase Solution I Takara 6022Q Dulbecco’s modified Eagle’s medium Gibco 12491015 FBS Gemini 100-106 Penicillin–streptomycin Gibco 15140-122 jetPRIME Polyplus 101000046 E. coli cells Sangon B528413 Software FlowJo v10 https://www.flowjo.com/flowjo10/ download Reagent/resource Reference or source Identifier or catalog number MEGA 12 https://www.megasoftware.net/ CRISPResso2 https://crispresso.pinellolab.org/ submission Cas-OFFinder http://www.rgenome.net/casoffinder ImageJ https://imagej.nih.gov/ij/index.html GraphPad Prism 8 https://www.graphpad.com Snapgene https://www.snapgene.com/ PyMol https://pymol.org/ Other Illumina NovaSeq (PE150) Novogene Technology (Beijing, China) Annaroad Gene Technology (Beijing, China) .. Mammalian codon-optimized sequences of Cas12n derived from Actinomadura craniellae (Ac) and Corynebacterium glutamicum (Cg) were synthesized by Genewiz and cloned into a CMV promoter-driven eukaryotic expression vector.

    Recombinant:

    Article Title: Chikungunya virus uses the tetraspanins CD63, CD9, and CD151 to replicate in human synovial fibroblasts.
    Article Snippet: .. Oligonucleotides Silencer negative control no. 2 siRNA Thermo Fisher Scientific Cat# AM4613 Silencer GFP siRNA Thermo Fisher Scientific Cat# AM4626 CATCTGCACCCAAGTGTACCA microsynth qPCR CHIKV fw GCGCATTTTGCCTTCGTAATG microsynth qPCR CHIKV rev 6FAM-CggTgTACACTgCCTgTgACYgC—BBQ TIB MolBiol CHIKV probe Recombinant DNA pczVSV-G Hoffmann et al.43 https://doi.org/10.1099/vir.0.023978–0 pIRES2-eGFP CHIKV E3-E1 Salvador et al.44 https://doi.org/10.1016/j.virol.2009.07.013 pChik-LR-5‘GFP Tsetsarkin et al.40 https://doi.org/10.1089/vbz.2006.6.325 pChikRepl-eGFP Gläsker et al.45 https://doi.org/10.1186/1743-422X-10–23 pcDNA3.1(+) Addgene Cat# V790-20 Software and algorithms Fiji – ImageJ https://github.com/fiji/fiji Version 2.14.0/1.54f Graph Pad Prism Dotmatics Version 10 Incucyte Sartorius Version 2020 FlowJo FlowJo LLC Version 10.10.1 Huygens Compute Engine Scientific Volume Imaging Version 26.04 Adobe Illustrator Adobe Version 29.8.7 Affinity Studio Affinity Version 3.2.1 BioRender BioRender (https://biorender.com) RRID:SCR_018361 Other Chamber slides 8 well Ibidi Cat# 80841 Cell Reports 45, 118058, October 27, 2026 13 .. For each target, 3 siRNAs were purchased from Thermo Fisher Scientific and pooled for reverse transfection (Table S1).

    Article Title: Engineering a compact CgCas12n platform for efficient genome and base editing in mammalian cells.
    Article Snippet: .. Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models HEK-293T ATCC CRL-3216 HeLa ATCC CCL-2 K562 ATCC CCL-243 N2a ATCC CCL-131 10 Molecular Systems Biology © The Author(s) Reagent/resource Reference or source Identifier or catalog number C2C12 ATCC CRL-1772 Mouse (C57BL/6), male, 4 weeks old Jiangsu GemPharmatech Co., Ltd SCXK (Su) 2018- 0008 Recombinant DNA AncBE4max Addgene #112094 ABE-max Addgene #112095 ABE-8e Addgene #138495 pCMV-nCas-PmCDA1 Addgene #79620 pCMV-AsCas12a Addgene #160140 pCMV-SpCas9 Addgene #139987 pGL3-U6-sgRNA-mCherry Our lab pCMV-CgCas12n Our lab pCMV-AcCas12n Our lab pCMV-enUnCas12f Our lab pCMV-TSminiCBE Our lab Antibodies Anti-Myhc DSHB MF 20 Anti-Dystrophin DSHB MANDRA1(7A10) Anti-Dystrophin Proteintech 12715-1-AP Anti-gapdh Proteintech 10494-1-AP Donkey anti-Mouse IgG (H+ L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 Invitrogen A-21202 Donkey anti-Rabbit IgG (H+ L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 555 Invitrogen A-31572 HRP Goat Anti-Rabbit IgG (H+ L) Abclonal AS014 HRP Goat Anti-Mouse IgG (H+ L) Abclonal AS003 Oligonucleotides and other sequence-based reagents Target sequence This study Appendix Tables S4–S8 Primer used for qPCR This study Appendix Table S9 Chemicals, enzymes, and other reagents Phanta Max Super-Fidelity DNA polymerase Vazyme P505 BasI-HFv2 NEB R3733 ClonExpress II One Step Cloning Kit Vazyme C116 DNA Ligase Solution I Takara 6022Q Dulbecco’s modified Eagle’s medium Gibco 12491015 FBS Gemini 100-106 Penicillin–streptomycin Gibco 15140-122 jetPRIME Polyplus 101000046 E. coli cells Sangon B528413 Software FlowJo v10 https://www.flowjo.com/flowjo10/ download Reagent/resource Reference or source Identifier or catalog number MEGA 12 https://www.megasoftware.net/ CRISPResso2 https://crispresso.pinellolab.org/ submission Cas-OFFinder http://www.rgenome.net/casoffinder ImageJ https://imagej.nih.gov/ij/index.html GraphPad Prism 8 https://www.graphpad.com Snapgene https://www.snapgene.com/ PyMol https://pymol.org/ Other Illumina NovaSeq (PE150) Novogene Technology (Beijing, China) Annaroad Gene Technology (Beijing, China) .. Mammalian codon-optimized sequences of Cas12n derived from Actinomadura craniellae (Ac) and Corynebacterium glutamicum (Cg) were synthesized by Genewiz and cloned into a CMV promoter-driven eukaryotic expression vector.

    Sequencing:

    Article Title: Engineering a compact CgCas12n platform for efficient genome and base editing in mammalian cells.
    Article Snippet: .. Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models HEK-293T ATCC CRL-3216 HeLa ATCC CCL-2 K562 ATCC CCL-243 N2a ATCC CCL-131 10 Molecular Systems Biology © The Author(s) Reagent/resource Reference or source Identifier or catalog number C2C12 ATCC CRL-1772 Mouse (C57BL/6), male, 4 weeks old Jiangsu GemPharmatech Co., Ltd SCXK (Su) 2018- 0008 Recombinant DNA AncBE4max Addgene #112094 ABE-max Addgene #112095 ABE-8e Addgene #138495 pCMV-nCas-PmCDA1 Addgene #79620 pCMV-AsCas12a Addgene #160140 pCMV-SpCas9 Addgene #139987 pGL3-U6-sgRNA-mCherry Our lab pCMV-CgCas12n Our lab pCMV-AcCas12n Our lab pCMV-enUnCas12f Our lab pCMV-TSminiCBE Our lab Antibodies Anti-Myhc DSHB MF 20 Anti-Dystrophin DSHB MANDRA1(7A10) Anti-Dystrophin Proteintech 12715-1-AP Anti-gapdh Proteintech 10494-1-AP Donkey anti-Mouse IgG (H+ L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 Invitrogen A-21202 Donkey anti-Rabbit IgG (H+ L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 555 Invitrogen A-31572 HRP Goat Anti-Rabbit IgG (H+ L) Abclonal AS014 HRP Goat Anti-Mouse IgG (H+ L) Abclonal AS003 Oligonucleotides and other sequence-based reagents Target sequence This study Appendix Tables S4–S8 Primer used for qPCR This study Appendix Table S9 Chemicals, enzymes, and other reagents Phanta Max Super-Fidelity DNA polymerase Vazyme P505 BasI-HFv2 NEB R3733 ClonExpress II One Step Cloning Kit Vazyme C116 DNA Ligase Solution I Takara 6022Q Dulbecco’s modified Eagle’s medium Gibco 12491015 FBS Gemini 100-106 Penicillin–streptomycin Gibco 15140-122 jetPRIME Polyplus 101000046 E. coli cells Sangon B528413 Software FlowJo v10 https://www.flowjo.com/flowjo10/ download Reagent/resource Reference or source Identifier or catalog number MEGA 12 https://www.megasoftware.net/ CRISPResso2 https://crispresso.pinellolab.org/ submission Cas-OFFinder http://www.rgenome.net/casoffinder ImageJ https://imagej.nih.gov/ij/index.html GraphPad Prism 8 https://www.graphpad.com Snapgene https://www.snapgene.com/ PyMol https://pymol.org/ Other Illumina NovaSeq (PE150) Novogene Technology (Beijing, China) Annaroad Gene Technology (Beijing, China) .. Mammalian codon-optimized sequences of Cas12n derived from Actinomadura craniellae (Ac) and Corynebacterium glutamicum (Cg) were synthesized by Genewiz and cloned into a CMV promoter-driven eukaryotic expression vector.

    Cloning:

    Article Title: Engineering a compact CgCas12n platform for efficient genome and base editing in mammalian cells.
    Article Snippet: .. Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models HEK-293T ATCC CRL-3216 HeLa ATCC CCL-2 K562 ATCC CCL-243 N2a ATCC CCL-131 10 Molecular Systems Biology © The Author(s) Reagent/resource Reference or source Identifier or catalog number C2C12 ATCC CRL-1772 Mouse (C57BL/6), male, 4 weeks old Jiangsu GemPharmatech Co., Ltd SCXK (Su) 2018- 0008 Recombinant DNA AncBE4max Addgene #112094 ABE-max Addgene #112095 ABE-8e Addgene #138495 pCMV-nCas-PmCDA1 Addgene #79620 pCMV-AsCas12a Addgene #160140 pCMV-SpCas9 Addgene #139987 pGL3-U6-sgRNA-mCherry Our lab pCMV-CgCas12n Our lab pCMV-AcCas12n Our lab pCMV-enUnCas12f Our lab pCMV-TSminiCBE Our lab Antibodies Anti-Myhc DSHB MF 20 Anti-Dystrophin DSHB MANDRA1(7A10) Anti-Dystrophin Proteintech 12715-1-AP Anti-gapdh Proteintech 10494-1-AP Donkey anti-Mouse IgG (H+ L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 Invitrogen A-21202 Donkey anti-Rabbit IgG (H+ L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 555 Invitrogen A-31572 HRP Goat Anti-Rabbit IgG (H+ L) Abclonal AS014 HRP Goat Anti-Mouse IgG (H+ L) Abclonal AS003 Oligonucleotides and other sequence-based reagents Target sequence This study Appendix Tables S4–S8 Primer used for qPCR This study Appendix Table S9 Chemicals, enzymes, and other reagents Phanta Max Super-Fidelity DNA polymerase Vazyme P505 BasI-HFv2 NEB R3733 ClonExpress II One Step Cloning Kit Vazyme C116 DNA Ligase Solution I Takara 6022Q Dulbecco’s modified Eagle’s medium Gibco 12491015 FBS Gemini 100-106 Penicillin–streptomycin Gibco 15140-122 jetPRIME Polyplus 101000046 E. coli cells Sangon B528413 Software FlowJo v10 https://www.flowjo.com/flowjo10/ download Reagent/resource Reference or source Identifier or catalog number MEGA 12 https://www.megasoftware.net/ CRISPResso2 https://crispresso.pinellolab.org/ submission Cas-OFFinder http://www.rgenome.net/casoffinder ImageJ https://imagej.nih.gov/ij/index.html GraphPad Prism 8 https://www.graphpad.com Snapgene https://www.snapgene.com/ PyMol https://pymol.org/ Other Illumina NovaSeq (PE150) Novogene Technology (Beijing, China) Annaroad Gene Technology (Beijing, China) .. Mammalian codon-optimized sequences of Cas12n derived from Actinomadura craniellae (Ac) and Corynebacterium glutamicum (Cg) were synthesized by Genewiz and cloned into a CMV promoter-driven eukaryotic expression vector.

    Modification:

    Article Title: Engineering a compact CgCas12n platform for efficient genome and base editing in mammalian cells.
    Article Snippet: .. Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models HEK-293T ATCC CRL-3216 HeLa ATCC CCL-2 K562 ATCC CCL-243 N2a ATCC CCL-131 10 Molecular Systems Biology © The Author(s) Reagent/resource Reference or source Identifier or catalog number C2C12 ATCC CRL-1772 Mouse (C57BL/6), male, 4 weeks old Jiangsu GemPharmatech Co., Ltd SCXK (Su) 2018- 0008 Recombinant DNA AncBE4max Addgene #112094 ABE-max Addgene #112095 ABE-8e Addgene #138495 pCMV-nCas-PmCDA1 Addgene #79620 pCMV-AsCas12a Addgene #160140 pCMV-SpCas9 Addgene #139987 pGL3-U6-sgRNA-mCherry Our lab pCMV-CgCas12n Our lab pCMV-AcCas12n Our lab pCMV-enUnCas12f Our lab pCMV-TSminiCBE Our lab Antibodies Anti-Myhc DSHB MF 20 Anti-Dystrophin DSHB MANDRA1(7A10) Anti-Dystrophin Proteintech 12715-1-AP Anti-gapdh Proteintech 10494-1-AP Donkey anti-Mouse IgG (H+ L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 Invitrogen A-21202 Donkey anti-Rabbit IgG (H+ L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 555 Invitrogen A-31572 HRP Goat Anti-Rabbit IgG (H+ L) Abclonal AS014 HRP Goat Anti-Mouse IgG (H+ L) Abclonal AS003 Oligonucleotides and other sequence-based reagents Target sequence This study Appendix Tables S4–S8 Primer used for qPCR This study Appendix Table S9 Chemicals, enzymes, and other reagents Phanta Max Super-Fidelity DNA polymerase Vazyme P505 BasI-HFv2 NEB R3733 ClonExpress II One Step Cloning Kit Vazyme C116 DNA Ligase Solution I Takara 6022Q Dulbecco’s modified Eagle’s medium Gibco 12491015 FBS Gemini 100-106 Penicillin–streptomycin Gibco 15140-122 jetPRIME Polyplus 101000046 E. coli cells Sangon B528413 Software FlowJo v10 https://www.flowjo.com/flowjo10/ download Reagent/resource Reference or source Identifier or catalog number MEGA 12 https://www.megasoftware.net/ CRISPResso2 https://crispresso.pinellolab.org/ submission Cas-OFFinder http://www.rgenome.net/casoffinder ImageJ https://imagej.nih.gov/ij/index.html GraphPad Prism 8 https://www.graphpad.com Snapgene https://www.snapgene.com/ PyMol https://pymol.org/ Other Illumina NovaSeq (PE150) Novogene Technology (Beijing, China) Annaroad Gene Technology (Beijing, China) .. Mammalian codon-optimized sequences of Cas12n derived from Actinomadura craniellae (Ac) and Corynebacterium glutamicum (Cg) were synthesized by Genewiz and cloned into a CMV promoter-driven eukaryotic expression vector.



    Similar Products

    15140 122 jetprime polyplus 101000046 e coli cells sangon b528413 software flowjo v10  (Sartorius AG)
    99
    Sartorius AG 15140 122 jetprime polyplus 101000046 e coli cells sangon b528413 software flowjo v10
    15140 122 Jetprime Polyplus 101000046 E Coli Cells Sangon B528413 Software Flowjo V10, supplied by Sartorius AG, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flowjo+software/jetPRIME+DNA%2FsiRNA/pm42800828-181-212-214
    Average 99 stars, based on 1 article reviews
    15140 122 jetprime polyplus 101000046 e coli cells sangon b528413 software flowjo v10 - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    algorithms flowjo software 10 10 tree star rrid scr 008520 graphpad prism 10 graphpad software  (Tree Star Inc)
    86
    Tree Star Inc algorithms flowjo software 10 10 tree star rrid scr 008520 graphpad prism 10 graphpad software
    Algorithms Flowjo Software 10 10 Tree Star Rrid Scr 008520 Graphpad Prism 10 Graphpad Software, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flowjo+software/flowjo10/pm41734064-296-7-11
    Average 86 stars, based on 1 article reviews
    algorithms flowjo software 10 10 tree star rrid scr 008520 graphpad prism 10 graphpad software - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    flowjo software  (Tree Star Inc)
    86
    Tree Star Inc flowjo software
    Flowjo Software, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flowjo+software/flowjo+software/pm41027248-62-23-25
    Average 86 stars, based on 1 article reviews
    flowjo software - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    flowjo software  (Oxford Instruments)
    99
    Oxford Instruments flowjo software
    Flowjo Software, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flowjo+software/Imaris/pm41138187-275-174-182
    Average 99 stars, based on 1 article reviews
    flowjo software - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    algorithms flowjo software flowjo  (Spectral Instruments Imaging)
    86
    Spectral Instruments Imaging algorithms flowjo software flowjo
    Algorithms Flowjo Software Flowjo, supplied by Spectral Instruments Imaging, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flowjo+software/aura+imaging+software/pm40803321-1328-248-257
    Average 86 stars, based on 1 article reviews
    algorithms flowjo software flowjo - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    algorithms flowjo software version 10 8 1 bd biosciences  (Dotmatics Limited)
    86
    Dotmatics Limited algorithms flowjo software version 10 8 1 bd biosciences
    Algorithms Flowjo Software Version 10 8 1 Bd Biosciences, supplied by Dotmatics Limited, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flowjo+software/omiq/pm41066244-196-143-152
    Average 86 stars, based on 1 article reviews
    algorithms flowjo software version 10 8 1 bd biosciences - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    h 5501 60 software flowjo bd  (Vector Laboratories)
    96
    Vector Laboratories h 5501 60 software flowjo bd
    H 5501 60 Software Flowjo Bd, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flowjo+software/VectaMount+AQ+Aqueous+Mounting+Medium/pm41057229-144-177-173
    Average 96 stars, based on 1 article reviews
    h 5501 60 software flowjo bd - by Bioz Stars, 2026-11
    96/100 stars
    		  Buy from Supplier
    flowjo 10 8 1 software  (TIBCO)
    96
    TIBCO flowjo 10 8 1 software
    Flowjo 10 8 1 Software, supplied by TIBCO, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flowjo+software/TIBCO+Data+Science/med_rxiv__2025__09__17__25336024-61-5-8
    Average 96 stars, based on 1 article reviews
    flowjo 10 8 1 software - by Bioz Stars, 2026-11
    96/100 stars
    		  Buy from Supplier
    algorithms flowjo software version 10 5 3 tree star  (Tree Star Inc)
    86
    Tree Star Inc algorithms flowjo software version 10 5 3 tree star
    Algorithms Flowjo Software Version 10 5 3 Tree Star, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flowjo+software/flowjo10/pm40975867-238-180-185
    Average 86 stars, based on 1 article reviews
    algorithms flowjo software version 10 5 3 tree star - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    algorithms incucyte s3 software sartorius prism 10 graphpad software flowjo bd compass  (Sartorius AG)
    99
    Sartorius AG algorithms incucyte s3 software sartorius prism 10 graphpad software flowjo bd compass
    Algorithms Incucyte S3 Software Sartorius Prism 10 Graphpad Software Flowjo Bd Compass, supplied by Sartorius AG, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flowjo+software/Live+Cell+Analysis+Instruments/pmc12490239__mmc8-200-17-21
    Average 99 stars, based on 1 article reviews
    algorithms incucyte s3 software sartorius prism 10 graphpad software flowjo bd compass - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier

    Image Search Results